Creation

The Origin of Life / The Future of Life

Author: Adam Rutherford

Publisher: Penguin UK

ISBN: 0141970227

Category: Science

Page: 272

View: 1764

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Evolution f?r Dummies

Author: Greg Krukonis,Tracy Barr

Publisher: John Wiley & Sons

ISBN: 3527669000

Category: Science

Page: 374

View: 1264

Von Ihrem K?rperbau bis zu Ihrem Verhalten bei der Partnerwahl - all Ihre vererbbaren Eigenschaften sind wie bei s?mtlichen Lebewesen dieser Erde durch die Evolution bestimmt. Aber was ist Evolution ?berhaupt? Was treibt sie an? Greg Krukonis und Tracy Barr nehmen Sie mit auf eine spannende Reise durch die Geschichte der Evolution - von Darwins Theorie bis zu den neusten wissenschaftlichen Erkenntnissen. Sie erfahren, was nat?rliche Selektion ist und wie sie funktioniert, welche wichtige Rolle die Genetik bei der Evolution der Arten spielt und wie sie f?r die unglaubliche Vielfalt des Lebens auf der Erde gesorgt hat.

Leben 3.0

Mensch sein im Zeitalter Künstlicher Intelligenz

Author: Max Tegmark

Publisher: Ullstein Buchverlage

ISBN: 3843716706

Category: Social Science

Page: 528

View: 6466

Die Nobelpreis-Schmiede Massachusetts Institute of Technology ist der bedeutendste technologische Think Tank der USA. Dort arbeitet Professor Max Tegmark mit den weltweit führenden Entwicklern künstlicher Intelligenz zusammen, die ihm exklusive Einblicke in ihre Labors gewähren. Die Erkenntnisse, die er daraus zieht, sind atemberaubend und zutiefst verstörend zugleich. Neigt sich die Ära der Menschen dem Ende zu? Der Physikprofessor Max Tegmark zeigt anhand der neusten Forschung, was die Menschheit erwartet. Hier eine Auswahl möglicher Szenarien: - Eroberer: Künstliche Intelligenz übernimmt die Macht und entledigt sich der Menschheit mit Methoden, die wir noch nicht einmal verstehen. - Der versklavte Gott: Die Menschen bemächtigen sich einer superintelligenten künstlichen Intelligenz und nutzen sie, um Hochtechnologien herzustellen. - Umkehr: Der technologische Fortschritt wird radikal unterbunden und wir kehren zu einer prä-technologischen Gesellschaft im Stil der Amish zurück. - Selbstzerstörung: Superintelligenz wird nicht erreicht, weil sich die Menschheit vorher nuklear oder anders selbst vernichtet. - Egalitäres Utopia: Es gibt weder Superintelligenz noch Besitz, Menschen und kybernetische Organismen existieren friedlich nebeneinander. Max Tegmark bietet kluge und fundierte Zukunftsszenarien basierend auf seinen exklusiven Einblicken in die aktuelle Forschung zur künstlichen Intelligenz.

Eine kurze Geschichte der Menschheit

Author: Yuval Noah Harari

Publisher: DVA

ISBN: 364110498X

Category: History

Page: 528

View: 4000

Krone der Schöpfung? Vor 100 000 Jahren war der Homo sapiens noch ein unbedeutendes Tier, das unauffällig in einem abgelegenen Winkel des afrikanischen Kontinents lebte. Unsere Vorfahren teilten sich den Planeten mit mindestens fünf weiteren menschlichen Spezies, und die Rolle, die sie im Ökosystem spielten, war nicht größer als die von Gorillas, Libellen oder Quallen. Vor 70 000 Jahren dann vollzog sich ein mysteriöser und rascher Wandel mit dem Homo sapiens, und es war vor allem die Beschaffenheit seines Gehirns, die ihn zum Herren des Planeten und zum Schrecken des Ökosystems werden ließ. Bis heute hat sich diese Vorherrschaft stetig zugespitzt: Der Mensch hat die Fähigkeit zu schöpferischem und zu zerstörerischem Handeln wie kein anderes Lebewesen. Anschaulich, unterhaltsam und stellenweise hochkomisch zeichnet Yuval Harari die Geschichte des Menschen nach und zeigt alle großen, aber auch alle ambivalenten Momente unserer Menschwerdung.

Eine kurze Geschichte von fast allem

Author: Bill Bryson

Publisher: Goldmann Verlag

ISBN: 3641079241

Category: Social Science

Page: 688

View: 4004

Wie groß ist eigentlich das Universum? Was wiegt unsere Erde? Und wie ist das überhaupt möglich – die Erde zu wiegen? In seinem großen Buch nimmt uns Bestsellerautor Bill Bryson mit auf eine atemberaubende Reise durch Raum und Zeit: Er erklärt uns den Himmel und die Erde, die Sterne und die Meere, und nicht zuletzt die Entstehungsgeschichte des Menschen. »Eine kurze Geschichte von fast allem« ist ein ebenso fundierter und lehrreicher wie unterhaltsamer und amüsanter Ausflug in die Naturwissenschaften, mit dem Bill Bryson das scheinbar Unmögliche vollbracht hat: das Wissen von der Welt in dreißig Kapitel zu packen, die auch für den normalen Leser ohne Vorkenntnisse verständlich sind. Das ideale Buch für alle, die unser Universum und unsere Geschichte endlich verstehen möchten – und dabei auch noch Spaß haben wollen!

Die Physik des Bewusstseins

Über die Zukunft des Geistes

Author: Michio Kaku

Publisher: Rowohlt Verlag GmbH

ISBN: 3644036411

Category: Science

Page: 544

View: 2536

Träume, die auf Video aufgenommen werden, Schreiben per Gedankensteuerung, Querschnittgelähmte, die Gliedmaßen wieder bewegen können - das alles gibt es schon. In den vergangenen 15 Jahren ist durch die Erfindung der Kernspintomografie eine Verbindung von Physik, Technik und Hirnforschung entstanden, die unser Wissen über Gehirn und Bewußtsein im Eiltempo gesteigert hat. Mithilfe komplexer Rechner und Maschinen werden wir in fernerer Zukunft Gedanken direkt aufzeichnen können, Musikstücke komponieren zum Beispiel oder Bücher verfassen. Via Internet könnten wir von Bewußtsein zu Bewußtsein kommunizieren. Es wird möglich sein, fremde Erinnerungen auf unser Hirn spielen und gute oder schlechte Gefühle. Unser Begriff von Bewußtsein und Intelligenz selbst und wird sich verändern. Wir stehen am Anfang einer wissenschaftlich-technischen Revolution, wohin wird sie uns führen? Michio Kaku entfaltet in diesem Buch ein grandioses Panorama des Wissens und der wissenschaftlichen Voraussage. Er hat sorgfältig recherchiert und dazu rund 300 Experten befragt. Manche denken weit voraus: Nicht auszuschließen, dass sich dereinst das Bewusstsein ganz vom Körper lösen lässt, um vielleicht auf fremden Planeten spazieren zu gehen. So faszinierend solche Entwicklungen sind, es wird schon jetzt Zeit, sie ethisch und politisch zu ordnen, erklärt der weltbekannte Physiker.

Eine kurze Geschichte der Zeit

Author: Stephen Hawking

Publisher: Rowohlt Verlag GmbH

ISBN: 3644008612

Category: Science

Page: 272

View: 4184

Ist das Universum unendlich oder begrenzt? Hat die Raumzeit einen Anfang, den Urknall? Dehnt sie sich aus? Wird sie wieder in sich zusammenstürzen? Liefe die Zeit dann rückwärts? Welchen Platz im Universum nehmen wir ein? Und ist in den atemberaubenden Modellen der Kosmologen noch Platz für einen Gott? – Es sind existenzielle Fragen, mit denen sich Stephen Hawking befasst, Fragen, die Forschung und Lehre in den Zentren der modernen Physik ebenso bestimmen wie die Diskussion von Geisteswissenschaftlern. Dieses Meisterwerk eines Jahrhundert-Genies hat unsere Weltsicht verändert. Zugleich hat Stephen Hawking damit neue Maßstäbe für die Erklärung komplexer physikalischer Zusammenhänge gesetzt. In diesem Buch, weltweit inzwischen über zehn Millionen Mal verkauft, ist das Credo des großen Physikers enthalten und lebendig. «Der Physiker Stephen Hawking ist im Begriff, die Formel zu finden, die das Universum erklärt.» ZEIT-Magazin

Alexander von Humboldt und die Erfindung der Natur

Author: Andrea Wulf

Publisher: C. Bertelsmann Verlag

ISBN: 3641195500

Category: Biography & Autobiography

Page: 560

View: 6254

Was hat Alexander von Humboldt, der vor mehr als 150 Jahren starb, mit Klimawandel und Nachhaltigkeit zu tun? Der Naturforscher und Universalgelehrte, nach dem nicht nur unzählige Straßen, Pflanzen und sogar ein »Mare« auf dem Mond benannt sind, hat wie kein anderer Wissenschaftler unser Verständnis von Natur als lebendigem Ganzen, als Kosmos, in dem vom Winzigsten bis zum Größten alles miteinander verbunden ist und dessen untrennbarer Teil wir sind, geprägt. Die Historikerin Andrea Wulf stellt in ihrem vielfach preisgekrönten – so auch mit dem Bayerischen Buchpreis 2016 – Buch Humboldts Erfindung der Natur, die er radikal neu dachte, ins Zentrum ihrer Erkundungsreise durch sein Leben und Werk. Sie folgt den Spuren des begnadeten Netzwerkers und zeigt, dass unser heutiges Wissen um die Verwundbarkeit der Erde in Humboldts Überzeugungen verwurzelt ist. Ihm heute wieder zu begegnen, mahnt uns, seine Erkenntnisse endlich zum Maßstab unseres Handelns zu machen – um unser aller Überleben willen.

Der Report der Magd

Roman

Author: Margaret Atwood

Publisher: Piper ebooks

ISBN: 3492970591

Category: Fiction

Page: 400

View: 2222

Die provozierende Vision eines totalitären Staats, in dem Frauen keine Rechte haben: Die Dienerin Desfred besitzt etwas, was ihr alle Machthaber, Wächter und Spione nicht nehmen können, nämlich ihre Hoffnung auf ein Entkommen, auf Liebe, auf Leben ... Margaret Atwoods »Report der Magd« wurde zum Kultbuch einer ganzen Generation und von Volker Schlöndorff unter dem Titel »Die Geschichte der Dienerin« verfilmt.

Homo Deus

Eine Geschichte von Morgen

Author: Yuval Noah Harari

Publisher: C.H.Beck

ISBN: 3406704026

Category: Social Science

Page: 576

View: 6828

In seinem Kultbuch „Eine kurze Geschichte der Menschheit“ erklärte Yuval Noah Harari, wie unsere Spezies die Erde erobern konnte. In „Homo Deus“ stößt er vor in eine noch verborgene Welt: die Zukunft. Was wird mit uns und unserem Planeten passieren, wenn die neuen Technologien dem Menschen gottgleiche Fähigkeiten verleihen – schöpferische wie zerstörerische – und das Leben selbst auf eine völlig neue Stufe der Evolution heben? Wie wird es dem Homo Sapiens ergehen, wenn er einen technikverstärkten Homo Deus erschafft, der sich vom heutigen Menschen deutlicher unterscheidet als dieser vom Neandertaler? Was bleibt von uns und der modernen Religion des Humanismus, wenn wir Maschinen konstruieren, die alles besser können als wir? In unserer Gier nach Gesundheit, Glück und Macht könnten wir uns ganz allmählich so weit verändern, bis wir schließlich keine Menschen mehr sind.

21 Lektionen für das 21. Jahrhundert

Author: Yuval Noah Harari

Publisher: C.H.Beck

ISBN: 3406727794

Category: History

Page: 459

View: 7764

Yuval Noah Harari ist der Weltstar unter den Historikern. In «Eine kurze Geschichte der Menschheit» erzählte er vom Aufstieg des Homo Sapiens zum Herrn der Welt. In «Homo Deus» ging es um die Zukunft unserer Spezies. Sein neues Buch schaut auf das Hier und Jetzt und konfrontiert uns mit den drängenden Fragen unserer Zeit. Wie unterscheiden wir Wahrheit und Fiktion im Zeitalter der Fake News? Was sollen wir unseren Kindern beibringen? Wie können wir in unserer unübersichtlichen Welt moralisch handeln? Wie bewahren wir Freiheit und Gleichheit im 21. Jahrhundert? Seit Jahrtausenden hat die Menschheit über den Fragen gebrütet, wer wir sind und was wir mit unserem Leben anfangen sollen. Doch jetzt setzen uns die heraufziehende ökologische Krise, die wachsende Bedrohung durch Massenvernichtungswaffen und der Aufstieg neuer disruptiver Technologien unter Zeitdruck. Bald schon wird irgendjemand darüber entscheiden müssen, wie wir die Macht nutzen, die künstliche Intelligenz und Biotechnologie bereit halten. Dieses Buch will möglichst viele Menschen dazu anregen, sich an den großen Debatten unserer Zeit zu beteiligen, damit die Antworten nicht von den blinden Kräften des Marktes gegeben werden.

Laudato si

Die Umwelt-Enzyklika des Papstes

Author: Franziskus (Papst),

Publisher: Verlag Herder GmbH

ISBN: 345180736X

Category: Religion

Page: 288

View: 6788

Mit großer Spannung wurde sie erwartet, auch von Nicht-Katholiken: Die Umwelt-Enzyklika von Papst Franziskus nimmt die heute entscheidenden Themen in den Blick; es geht um die geht um soziale, ökologische und politische Zusammenhänge. Wohl selten war ein päpstliches Schreiben so aktuell und brisant und vor allem relevant für alle Gesellschaftsschichten und Menschen weltweit. Mit "Laudato si" beweist Franziskus, dass die Kirche nach wie vor eine unverzichtbare Stimme im Diskurs zur Gestaltung der modernen Welt ist. Wer verstehen will, wie Papst und Kirche die großen Herausforderungen unserer Zeit bestehen wollen, kommt an diesem Werk nicht vorbei. Ein Muss für jeden, der an den drängenden Fragen unserer Zeit interessiert ist.

Kurze Antworten auf große Fragen

Author: Stephen Hawking

Publisher: Klett-Cotta

ISBN: 3608115102

Category: Political Science

Page: 160

View: 9918

Stephen Hawkings Vermächtnis In seinem letzten Buch gibt Stephen Hawking Antworten auf die drängendsten Fragen unserer Zeit und nimmt uns mit auf eine persönliche Reise durch das Universum seiner Weltanschauung. Seine Gedanken zu Ursprung und Zukunft der Menschheit sind zugleich eine Mahnung, unseren Heimatplaneten besser vor den Gefahren unserer Gegenwart zu schützen. Zugänglich und klar finden Sie in diesem Buch Hawkings Antworten auf die drängendsten Fragen unserer Zeit. - Warum gibt es uns Menschen überhaupt? - Und woher kommen wir? - Gibt es im Weltall andere intelligente Lebewesen? - Existiert Gott? - In welchem Zustand befindet sich unser Heimatplanet? - Werden wir auf der Erde überleben? - Retten oder zerstören uns Naturwissenschaften und Technik? - Hilft uns die künstliche Intelligenz, die Erde zu bewahren? - Können wir den Weltraum bevölkern? - Wie werden wir die Schwächsten – Kinder, Kranke, alte Menschen – schützen? - Wie werden wir unsere Kinder erziehen? Brillanter Physiker, revolutionärer Kosmologe, unerschütterlicher Optimist. Für Stephen Hawking bergen die Weiten des Universums nicht nur naturwissenschaftliche Geheimnisse. In seinem persönlichsten Buch beantwortet der Autor die großen Fragen des menschlichen Lebens und spricht die wichtigsten Themen unserer Zeit an. Zugänglich und klar erläutert er die Folgen des menschlichen Fortschritts – vom Klimawandel bis hin zu künstlicher Intelligenz – und diskutiert seine Gefahren. Hier finden Sie Hawkings Antworten auf die Urfragen der Menschheit. Ein großer Appell an politische Machthaber und jeden Einzelnen von uns, unseren bedrohten Heimatplaneten besser zu schützen.

Aufklärung jetzt

Für Vernunft, Wissenschaft, Humanismus und Fortschritt. Eine Verteidigung

Author: Steven Pinker

Publisher: S. Fischer Verlag

ISBN: 3104030685

Category: Philosophy

Page: 736

View: 9620

Eine leidenschaftliche Antithese zum üblichen Kulturpessimismus und ein engagierter Widerspruch zu dem weitverbreiteten Gefühl, dass die Moderne dem Untergang geweiht ist. Hass, Populismus und Unvernunft regieren die Welt, Wissenschaftsfeindlichkeit macht sich breit, Wahrheit gibt es nicht mehr: Wer die Schlagzeilen von heute liest, könnte so denken. Doch Bestseller-Autor Steven Pinker zeigt, dass das grundfalsch ist. Er hat die Entwicklung der vergangenen Jahrhunderte gründlich untersucht und beweist in seiner fulminanten Studie, dass unser Leben stetig viel besser geworden ist. Heute leben wir länger, gesünder, sicherer, glücklicher, friedlicher und wohlhabender denn je, und nicht nur in der westlichen Welt. Der Grund: die Aufklärung und ihr Wertesystem. Denn Aufklärung und Wissenschaft bieten nach wie vor die Basis, um mit Vernunft und im Konsens alle Probleme anzugehen. Anstelle von Gerüchten zählen Fakten, anstatt überlieferten Mythen zu glauben baut man auf Diskussion und Argumente. Anschaulich und brillant macht Pinker eines klar: Vernunft, Wissenschaft, Humanismus und Fortschritt sind weiterhin unverzichtbar für unser Wohlergehen. Ohne sie wird die Welt auf keinen Fall zu einem besseren Ort für uns alle. »Mein absolutes Lieblingsbuch aller Zeiten.« Bill Gates

Comets And Their Origin

The Tools To Decipher A Comet

Author: Uwe Meierhenrich

Publisher: John Wiley & Sons

ISBN: 3527412794

Category: Science

Page: 352

View: 3048

Divided into two parts, the first four chapters of Comets and their Origin refer to comets and their formation in general, describing cometary missions, comet remote observations, astrochemistry, artificial comets, and the chirality phenomenon. The second part covers the cometary ROSETTA mission, its launch, journey, scientific objectives, and instrumentations, as well as the landing scenario on a cometary nucleus. Along the way, the author presents general questions concerning the origin of terrestrial water and the molecular beginnings of life on Earth, as well as how the instruments used on a space mission like ROSETTA can help answer them. The text concludes with a chapter on what scientists expect from the ROSETTA mission and how its data will influence our life on Earth. As a result, the author elucidates highly topical and fascinating knowledge to scientists and students of various scientific backgrounds, allowing them to work with ROSETTA's data.

Mach, was Du willst

Design Thinking fürs Leben

Author: Bill Burnett,Dave Evans

Publisher: Ullstein eBooks

ISBN: 3843713634

Category: Self-Help

Page: 288

View: 6776

Design Thinking hilft, kreative Lösungen für komplexe Probleme zu finden. Die Autoren übertragen dieses Prinzip auf das Leben und die Berufswahl. Denke wie ein Designer: Stelle Fragen, suche Verbündete, mache Fehler, baue Prototypen, denke interdisziplinär – und werde zum Designer deines eigenen Lebens! Diese Ideen präsentieren die beiden Professoren seit sieben Jahren an der Stanford University,was zu chronisch überbuchten Kursen führt.

The Book

The Life Story of a Technology

Author: Nicole Howard

Publisher: Greenwood Publishing Group

ISBN: 9780313330285

Category: History

Page: 171

View: 8065

Introduces the history of the book, beginning with papyrus in ancient Egypt, through the development of the printing press, to current computer-based technologies, including its influence on societies and cultures around the world.

Exploring the Origin, Extent, and Future of Life

Philosophical, Ethical and Theological Perspectives

Author: Constance M. Bertka

Publisher: Cambridge University Press

ISBN: 0521863635

Category: Religion

Page: 324

View: 8738

Philosophers, historians, ethicists, and theologians provide the perspectives of their fields on astrobiology for graduate students and researchers.

Artificial Life

The Quest for a New Creation

Author: Steven Levy

Publisher: N.A

ISBN: 9780140231052

Category: Artificial intelligence

Page: 390

View: 6054

This book looks at artificial life science - A-Life, an important new area of scientific research involving the disciplines of microbiology, evolutionary theory, physics, chemistry and computer science. In the 1940s a mathematician named John von Neumann, a man with a claim to being the father of the modern computer, invented a hypothetical mathematical entity called a cellular automaton. His aim was to construct a machine that could reproduce itself. In the years since, with the development of hugely more sophisticated and complex computers, von Neumann's insights have gradually led to a point where scientists have created, within the wiring of these machines, something that so closely simulates life that it may, arguably, be called life. This machine reproduces itself, mutates, evolves through generations and dies.